Review



iscript ssoadvanced tm syber green master supermix  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad iscript ssoadvanced tm syber green master supermix
    Iscript Ssoadvanced Tm Syber Green Master Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 5058 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+ssoadvanced+tm+syber+green+master+supermix/IQ+Sybr+Green+Super+Mix/pmc12500471-164-12-19
    Average 99 stars, based on 5058 article reviews
    iscript ssoadvanced tm syber green master supermix - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: GABAergic signaling contributes to tumor cell invasion and poor overall survival in colorectal cancer
    Article Snippet: Cellular RNA was extracted as outlined above (RNAseq), and cDNA was reverse transcribed using iScript Reverse Transcription Supermix (Bio-Rad, #1708841) following the manufacturer’s instructions. .. The cDNA was then amplified using iScript SYBR Green Master Supermix or iScript SsoAdvanced TM SYBER Green Master Supermix (Bio-Rad; #1708880 or #1725271). .. Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for primers are as follows: GAPDH: F 5’-TCTGGTAAAGTGGATATTGTTG-3’, R 5’-GATGGTGATGGGATTTCC-3’; TFRC: F 5’-GTTGAATTGAACCTGGAC-3’, R: 5’-AAGTAGCACGGAAGAAGT-3’; E-Cadherin: F 5’-TTTGTACAGATGGGGTCTTGC-3’, R 5’-CAAGCCCACTTTTCATAGTTCC-3’; Snail: F 5’-ACCACTATGCCGCGCTCTT-3’, R 5’-GGTCGTAGGGCTGCTGGAA-3’; Ki67: F 5’- CTTTGGGTGCGACTTGACG-3’, R 5’- GTCGACCCCGCTCCTTTT-3’.

    Article Title: Integration of Patient-Derived Organoids and Organ-on-Chip Systems: Investigating Colorectal Cancer Invasion within the Mechanical and GABAergic Tumor Microenvironment
    Article Snippet: Cellular RNA was extracted as outlined above (RNAseq) and cDNA was reverse transcribed using iScript Reverse Transcription Supermix (Bio-Rad, #1708841) following manufacturer’s instructions. .. The cDNA was then amplified using iScript SYBR Green Master Supermix or iScript SsoAdvanced TM SYBER Green Master Supermix (Bio-Rad; #1708880 or #1725271). .. Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows: F 5’TCTGGTAAAGTGGATATTGTTG3’; F 5’GATGGTGATGGGATTTCC3’.

    SYBR Green Assay:

    Article Title: GABAergic signaling contributes to tumor cell invasion and poor overall survival in colorectal cancer
    Article Snippet: Cellular RNA was extracted as outlined above (RNAseq), and cDNA was reverse transcribed using iScript Reverse Transcription Supermix (Bio-Rad, #1708841) following the manufacturer’s instructions. .. The cDNA was then amplified using iScript SYBR Green Master Supermix or iScript SsoAdvanced TM SYBER Green Master Supermix (Bio-Rad; #1708880 or #1725271). .. Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for primers are as follows: GAPDH: F 5’-TCTGGTAAAGTGGATATTGTTG-3’, R 5’-GATGGTGATGGGATTTCC-3’; TFRC: F 5’-GTTGAATTGAACCTGGAC-3’, R: 5’-AAGTAGCACGGAAGAAGT-3’; E-Cadherin: F 5’-TTTGTACAGATGGGGTCTTGC-3’, R 5’-CAAGCCCACTTTTCATAGTTCC-3’; Snail: F 5’-ACCACTATGCCGCGCTCTT-3’, R 5’-GGTCGTAGGGCTGCTGGAA-3’; Ki67: F 5’- CTTTGGGTGCGACTTGACG-3’, R 5’- GTCGACCCCGCTCCTTTT-3’.

    Article Title: Integration of Patient-Derived Organoids and Organ-on-Chip Systems: Investigating Colorectal Cancer Invasion within the Mechanical and GABAergic Tumor Microenvironment
    Article Snippet: Cellular RNA was extracted as outlined above (RNAseq) and cDNA was reverse transcribed using iScript Reverse Transcription Supermix (Bio-Rad, #1708841) following manufacturer’s instructions. .. The cDNA was then amplified using iScript SYBR Green Master Supermix or iScript SsoAdvanced TM SYBER Green Master Supermix (Bio-Rad; #1708880 or #1725271). .. Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows: F 5’TCTGGTAAAGTGGATATTGTTG3’; F 5’GATGGTGATGGGATTTCC3’.



    Similar Products

    99
    Bio-Rad iscript ssoadvanced tm syber green master supermix
    Iscript Ssoadvanced Tm Syber Green Master Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+ssoadvanced+tm+syber+green+master+supermix/IQ+Sybr+Green+Super+Mix/pmc12500471-164-12-19
    Average 99 stars, based on 1 article reviews
    iscript ssoadvanced tm syber green master supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results